Beispiele

To illustrate the power of the MW-ANN database retrieval system we have chosen the well know human alpha-globin (HBA) gene as example.

 

ID HSAGLO1 standard; RNA; PRI; 575 BP.
XX
AC V00493;
XX
DT 03-NOV-1982 (Rel. 02, Created)
DT 23-DEC-1994 (Rel. 42, Last updated, Version 6)
XX
DE Human messenger RNA for alpha globin.
.
.
XX
FH Key Location/Qualifiers
FH
FT source 1..575
FT /organism="Homo sapiens"
FT mRNA 1..575
FT /note="messenger RNA"
FT misc_RNA 1..1
FT /note="capped by m7G-ppp"
FT CDS 38..466
FT /note="reading frame alpha-globin"
FT /note="pid:g28558"
FT polyA_site 575..575
FT /note="polyA addition site"
XX
SQ Sequence 575 BP; 101 A; 211 C; 158 G; 105 T; 0 other;
actcttctgg tccccacaga ctcagagaga acccaccATG GTGCTGTCTC CTGCCGACAA 60
GACCAACGTC AAGGCCGCCT GGGGCAAGGT TGGCGCGCAC GCTGGCGAGT ATGGTGCGGA 120
GGCCCTGGag aggatgttcc tgtccttccc caccaccaag acctacttcc cgcacttcga 180
cctgagccac ggctctgccc aggttaaggg ccacggcaag aaggtggccg acgcgctgac 240
caacgccgtg gcgcacgtgg acgacatgcc caacgcgctg tccgccctga gcgacctgca 300
cgcgcacaag cttcgggtgg acccggtcaa cttcaagctc ctaagccact gcctgctggt 360
gaccctggcc gcccacctcc ccgccgagtt cacccctgcg gtgcacgcct ccctggacaa 420
gttcctggct tctgtgagca ccgtgctgac ctccaaatac cgttaagctg gagcctcggt 480
agcagttcct cctgccagat gggcctccca acgggccctc ctcccctcct tgcaccggcc 540
cttcctggtc tttgaataaa gtctgagtgg gcggc 575

 

 

//Fig. 1: The used EMBL database entry for humanalpha globin (HBA).  

 

For the following example searches we created a "mutated" fragment and took the fragment in the "original" version also.

The "mutated" fragment contains additional "A"s at every 10th position (Fig 2 big, bold letters) of the 110 base pairs. The "original" was the same sequence without the added "A"s (91 base pairs).

Search Example with "original" human HBA Sequence Fragment

 

    atggtgctgt ctcctgccga caagaccaac gtcaaggccg cctggggcaa ggttggcgcg 
cacgctggcg agtatggtgc ggaggccctg g

 

Search Example with "mutated" human HBA Sequence Fragment

 

    atggtgctgt Actcctgccg Aacaagacca Aacgtcaagg Accgcctggg Agcaaggttg 
Agcgcgcacg Actggcgagt Aatggtgcgg Aaggccctgg

 

 

Fig. 2: The two fragments that where usedfor the example searches below. 

 

The "original" and the "mutated" where use to conduct MWANN-D, FASTA and BLASTN database searches against the EMBL Dec 95.


MW-ANN-D with "original" human HBA Sequence Fragment

 

                                        ZONE IN        ZONE IN 
ID........ DE...................... .DATABASE SEQ.. ..SEARCH SEQ.. SCORE
HSAGLO1 |Human messenger RNA for 38- 128 1- 91 455
PTGL03 |Pan troglodytes alpha2-g 38- 128 1- 91 441
PTGL02 |Pan troglodytes alpha-gl 38- 128 1- 91 441
HSHBA4 |Human alpha globin psi-a 10514- 10604 1- 91 441
HSHBA4 |Human alpha globin psi-a 6703- 6793 1- 91 441
HSGL04 |Human gene encoding alph 38- 128 1- 91 441
HSAGL4 |Human gene for alpha 1 g 84- 174 1- 91 441
HSAGL2 |Human alpha-globin gene 38- 128 1- 91 441
HSAGL1 |Human alpha-globin germ 135- 225 1- 91 441
HLALUS |Gibbon tandemly arranged 8435- 8525 1- 91 434
S79498 |alpha-globin loci: alpha 2786- 2876 1- 91 427
MMHBA |Rhesus monkey alpha-glob 56- 146 1- 91 427
HLALUS |Gibbon tandemly arranged 3752- 3842 1- 91 427
A18169 |Alpha globin gene seq ID 1- 88 4- 91 426
PPHBA02 |Orangutan alpha-1-globin 109- 199 1- 91 420
PPHBA01 |Orangutan alpha-2-globin 109- 199 1- 91 420
PAA1GL |P.anubis alpha-1 globin 109- 199 1- 91 406
ECPZA2GL |Horse psi zeta and alpha 3481- 3571 1- 91 392
ECHBA22 |Horse BI alpha-1 globin 218- 308 1- 91 392
ESGLOB01 |Equine BII alpha-1 globi 132- 222 1- 91 385
ECHBA2A2 |Horse BII alpha-1 globin 210- 300 1- 91 385
ECHBA2A1 |Horse BII alpha-2 globin 190- 280 1- 91 385
GCHBBA6 |G.crassicaudatus hemoglo 396- 486 1- 91 378
GCHBBA1 |G.crassicaudatus hemoglo 1195- 1285 1- 91 371
OOAHG |O.aries II alpha/I alpha 40- 130 1- 91 364
OOAG113HI |O.aries II alpha (113 Hi 40- 130 1- 91 364

 

 

                                        ZONE IN         ZONE IN 
ID........ DE...................... .DATABASE SEQ.. ..SEARCH SEQ.. SCORE
HSAGLO1 |Human messenger RNA for 38- 128 1- 91 455

 

 

atggtgctgtctcctgccgacaagaccaacgtcaaggccgcctggggcaaggttggcgcg 
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
atggtgctgtctcctgccgacaagaccaacgtcaaggccgcctggggcaaggttggcgcg

 

 

cacgctggcgagtatggtgcggaggccctgg
|||||||||||||||||||||||||||||||
cacgctggcgagtatggtgcggaggccctgg

 

 

                                       ZONE IN          ZONE IN 
ID........ DE...................... .DATABASE SEQ.. ..SEARCH SEQ.. SCORE
PTGL03 |Pan troglodytes alpha2-g 38- 128 1- 91 441

 

 

atggtgctgtctcctgccgacaagaccaacgtcaaggccgcctggggtaaggtcggcgcg 
||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||
atggtgctgtctcctgccgacaagaccaacgtcaaggccgcctggggcaaggttggcgcg

 

 

cacgctggcgagtatggtgcggaggccctgg
|||||||||||||||||||||||||||||||
cacgctggcgagtatggtgcggaggccctgg

 

 

                                       ZONE IN          ZONE IN 
ID........ DE...................... .DATABASE SEQ.. ..SEARCH SEQ.. SCORE
PTGL02 |Pan troglodytes alpha-gl 38- 128 1- 91 441

 

 

atggtgctgtctcctgccgacaagaccaacgtcaaggccgcctggggtaaggtcggcgcg 
||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||
atggtgctgtctcctgccgacaagaccaacgtcaaggccgcctggggcaaggttggcgcg

 

 

cacgctggcgagtatggtgcggaggccctgg
|||||||||||||||||||||||||||||||
cacgctggcgagtatggtgcggaggccctgg